Mutants (Isolated)

tm4950

Allele Nametm4950
Sequence NameZK673.4
CGC NameZK673.4
Worm BaseAllele Name tm4950
CGC Name ZK673.4
Sequence ZK673.4
Phenotypehomozygous viable.
Mutation site11193/11194-AATGTG-11683/11684 (490 bp deletion + 6 bp insertion)
ChromosomeII
Putative gene structurejoin(10693..10737, 10873..10963, 11100..11260, 11708..11881, 11937..12167, 12211..12459, 12511..12990)
Map position2.62
Balancer
Map position of balancer
Sequence of primersIntRev:AAGCCGTACCTCATCCGCGA,IntFwd:CAGCCTCCGCAAGTTACTCT,ExtRev:TAGGATGAGGTGCTCGGCTG,ExtFwd:CAGGTTCCACGTATCCACAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
McCloskey RJ, Kemphues KJ.
Deubiquitylation machinery is required for embryonic polarity in Caenorhabditis elegans.
PLoS Genet. 2012 8(11) e1003092 
[ PubMed ID = 23209443 ] [ RRC reference ]