Home > Mutants (Isolated) > tm4948

Mutants (Isolated)

Allele Name		tm4948
Sequence Name		C34C6.6
CGC Name		prx-5
Worm Base	Allele Name	tm4948
	CGC Name	prx-5
	Sequence	C34C6.6
Phenotype		lethal or sterile.
Mutation site		32467/32468-32904/32905 (437 bp deletion)
Chromosome		II
Putative gene structure		join(32563..32662, 32712..32896, 32945..33289, 33338..33568, 33714..33803, 33856..34319, 34366..34459)
Map position		0.85
Balancer		mIn1
Map position of balancer
Sequence of primers		IntRev:GCATCCAAGAATCTAGCCTC,ExtRev:GCCAACTTGAGAGAGTCGAC,IntFwd:CTACACTGGGGCCCACTTAT,ExtFwd:CGACCTCCGTTGTTCCTTAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Wang R, Kniazeva M, Han M. Peroxisome protein transportation affects metabolism of branched-chain fatty acids that critically impact growth and development of C. elegans. PLoS One 2013 8(9) e76270  [ PubMed ID = 24086720 ] [ RRC reference ] Van Veldhoven PP, Baes M. Peroxisome deficient invertebrate and vertebrate animal models. Front Physiol 2013 4 335  [ PubMed ID = 24319432 ] [ RRC reference ]