Mutants (Isolated)

tm4948

Allele Nametm4948
Sequence NameC34C6.6
CGC Nameprx-5
Worm BaseAllele Name tm4948
CGC Name prx-5
Sequence C34C6.6
Phenotypelethal or sterile.
Mutation site32467/32468-32904/32905 (437 bp deletion)
ChromosomeII
Putative gene structurejoin(32563..32662, 32712..32896, 32945..33289, 33338..33568, 33714..33803, 33856..34319, 34366..34459)
Map position0.85
BalancermIn1
Map position of balancer
Sequence of primersIntRev:GCATCCAAGAATCTAGCCTC,ExtRev:GCCAACTTGAGAGAGTCGAC,IntFwd:CTACACTGGGGCCCACTTAT,ExtFwd:CGACCTCCGTTGTTCCTTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang R, Kniazeva M, Han M.
Peroxisome protein transportation affects metabolism of branched-chain fatty acids that critically impact growth and development of C. elegans.
PLoS One 2013 8(9) e76270 
[ PubMed ID = 24086720 ] [ RRC reference ]

Van Veldhoven PP, Baes M.
Peroxisome deficient invertebrate and vertebrate animal models.
Front Physiol 2013 4 335 
[ PubMed ID = 24319432 ] [ RRC reference ]