Mutants (Isolated)

tm4947

Allele Nametm4947
Sequence NameC10G11.7
CGC NameC10G11.7
Worm BaseAllele Name tm4947
CGC Name C10G11.7
Sequence C10G11.7
Phenotypehomozygous viable.
Mutation site15318/15319-15703/15704 (385 bp deletion)
ChromosomeI
Putative gene structurejoin(13343..13708, 14999..15157, 15371..15688, 15762..15935)
Map position0.9
Balancer
Map position of balancer
Sequence of primersExtFwd:ATTGGTTGAACCGCGCTGCT,IntFwd:CTGATGCAAACGCACTTCTG,ExtRev:ACATCCCGCCAGACGGTCAT,IntRev:CTAATTTGCAGCGACGGCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Guan L, Ma X, Zhang J, Liu JJ, Wang Y, Ding M.
The Calponin Family Member CHDP-1 Interacts with Rac/CED-10 to Promote Cell Protrusions.
PLoS Genet 2016 12(7) e1006163 
[ PubMed ID = 27415421 ] [ RRC reference ]