Mutants (Isolated)

tm4941

Allele Nametm4941
Sequence NameY45F10D.4
CGC NameY45F10D.4
Worm BaseAllele Name tm4941
CGC Name Y45F10D.4
Sequence Y45F10D.4
Phenotypelethal or sterile
Mutation site24017/24018-24613/24614 (596 bp deletion)
ChromosomeIV
Putative gene structurejoin(24218..24307, 24366..24485, 24549..24732, 24787..24854)
Map position10.84
BalancernT1
Map position of balancer
Sequence of primersIntRev:TGATGCGAATTGCGAGCATC,IntFwd:GCGCCTTTACTACAGTATGT,ExtFwd:CCCGCTAGGGTTCAAAATAC,ExtRev:GGGTATGCAAATCTCGAAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ast T, Meisel JD, Patra S, Wang H, Grange RMH, Kim SH, Calvo SE, Orefice LL, Nagashima F, Ichinose F, Zapol WM, Ruvkun G, Barondeau DP, Mootha VK.
Hypoxia Rescues Frataxin Loss by Restoring Iron Sulfur Cluster Biogenesis.
Cell 2019 177(6) 1507-1521.e16 
[ PubMed ID = 31031004 ] [ RRC reference ]