Home > Mutants (Isolated) > tm4931

Mutants (Isolated)

Allele Name		tm4931
Allele Type		Balanced
Sequence Name		F54C8.5
Gene Name		rheb-1
Worm Base	Allele Name	tm4931
	Gene Name	rheb-1
	Sequence	F54C8.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		20590/20591-21070/21071 (480 bp deletion)
Chromosome		III
Putative gene structure		complement(join(20814..20957, 21356..21482, 21531..21587, 21639..21735, 21789..21914, 22041..22113))
Map position		0.52
Balancer		hT2,hT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primers		IntFwd:GTAAACCGGTGTAAGGCACT,ExtFwd:TACCAGGTAGATTAGGAGTG,ExtRev:GGCTCAAATTGGCGGCCGTT,IntRev:CTGCAGGTTTGCTTGGGTAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Duong T, Rasmussen NR, Ballato E, Mote FS, Reiner DJ. The Rheb-TORC1 signaling axis functions as a developmental checkpoint. Development 2020 147(5)   [ PubMed ID = 32041790 ] [ RRC reference ]