Mutants (Isolated)

tm4927

Allele Nametm4927
Sequence NameY47G6A.17
CGC NameY47G6A.17
Worm BaseAllele Name tm4927
CGC Name Y47G6A.17
Sequence Y47G6A.17
PhenotypeLet or Ste.
Mutation site65550/65551-66427/66428 (877 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(60036..60112, 60166..60304, 60853..61096, 61145..61323, 61794..62108, 62226..62577, 62920..63209, 63449..63752, 63803..63921, 64477..65137, 65184..65281, 65632..65769, 65925..66326, 67009..67113))
Map position-3.2
Balancer
Map position of balancer
Sequence of primersExtFwd:TGTAGTTGCATCGACAAGCT,IntFwd:TTAGTTCATCTTGCAGCCCT,ExtRev:GCGTGCTAGAAATTGGTGGT,IntRev:AGGACGTACCTTCTTACAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Schouteden C, Serwas D, Palfy M, Dammermann A.
The ciliary transition zone functions in cell adhesion but is dispensable for axoneme assembly in C. elegans.
J Cell Biol 2015 210(1) 35-44 
[ PubMed ID = 26124290 ] [ RRC reference ]

Serwas D, Su TY, Roessler M, Wang S, Dammermann A.
Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans.
J Cell Biol 2017 216(6) 1659-1671 
[ PubMed ID = 28411189 ] [ RRC reference ]