| Allele Name | tm4927 |
| Allele Type | Balanced |
| Sequence Name | Y47G6A.17 |
| Gene Name | Y47G6A.17 |
| Worm Base | Allele Name |
tm4927
|
| Gene Name |
Y47G6A.17
|
| Sequence |
Y47G6A.17
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 65550/65551-66427/66428 (877 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(60036..60112, 60166..60304, 60853..61096, 61145..61323, 61794..62108, 62226..62577, 62920..63209, 63449..63752, 63803..63921, 64477..65137, 65184..65281, 65632..65769, 65925..66326, 67009..67113)) |
| Map position | -3.2 |
| Balancer | hT2 bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | IntRev:AGGACGTACCTTCTTACAGT,ExtRev:GCGTGCTAGAAATTGGTGGT,IntFwd:TTAGTTCATCTTGCAGCCCT,ExtFwd:TGTAGTTGCATCGACAAGCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
De-Castro ARG, Rodrigues DRM, De-Castro MJG, Vieira N, Vieira C, Carvalho AX, Gassmann R, Abreu CMC, Dantas TJ.
WDR60-mediated dynein-2 loading into cilia powers retrograde IFT and transition zone crossing.
J Cell Biol 2022 221(1)
[ PubMed ID = 34739033 ]
[ RRC reference ]
|
Serwas D, Su TY, Roessler M, Wang S, Dammermann A.
Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans.
J Cell Biol 2017 216(6) 1659-1671
[ PubMed ID = 28411189 ]
[ RRC reference ]
|
Schouteden C, Serwas D, Palfy M, Dammermann A.
The ciliary transition zone functions in cell adhesion but is dispensable for axoneme assembly in C. elegans.
J Cell Biol 2015 210(1) 35-44
[ PubMed ID = 26124290 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.