Mutants (Isolated)

tm4919

Allele Nametm4919
Sequence NameZC376.7
CGC Nameatfs-1
Worm BaseAllele Name tm4919
CGC Name atfs-1
Sequence ZC376.7
Phenotypehomozygous viable. Homozygotes tend to be sterile.
Mutation site25513/25514-25847/25848 (334 bp deletion)
ChromosomeV
Putative gene structurejoin(25621..25716, 25771..25841, 25891..26266, 27353..27424, 27477..27557, 27691..28343, 28442..28559)
Map position6.2
Balancer
Map position of balancer
Sequence of primersIntRev:TCCCGTACCATATTATCTCC,ExtRev:GTCGGCAATGCGAAAAAGAT,IntFwd:ATCCCCATAATGGTTCGCTG,ExtFwd:CACTGCCAATGTGAGTCATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Deng P, Uma Naresh N, Du Y, Lamech LT, Yu J, Zhu LJ, Pukkila-Worley R, Haynes CM.
Mitochondrial UPR repression during Pseudomonas aeruginosa infection requires the bZIP protein ZIP-3.
Proc. Natl. Acad. Sci. U.S.A. 2019 116(13) 6146-6151 
[ PubMed ID = 30850535 ] [ RRC reference ]

Haroon S, Li A, Weinert JL, Fritsch C, Ericson NG, Alexander-Floyd J, Braeckman BP, Haynes CM, Bielas JH, Gidalevitz T, Vermulst M.
Multiple Molecular Mechanisms Rescue mtDNA Disease in C. elegans.
Cell Rep 2018 22(12) 3115-3125 
[ PubMed ID = 29562168 ] [ RRC reference ]

Oks O, Lewin S, Goncalves IL, Sapir A.
The UPRmt Protects Caenorhabditis elegans from Mitochondrial Dysfunction by Upregulating Specific Enzymes of the Mevalonate Pathway.
Genetics 2018 209(2) 457-473 
[ PubMed ID = 29599115 ] [ RRC reference ]

Kaufman DM, Wu X, Scott BA, Itani OA, Van Gilst MR, Bruce JE, Crowder CM.
Ageing and hypoxia cause protein aggregation in mitochondria.
Cell Death Differ. 2017 24(10) 1730-1738 
[ PubMed ID = 28644434 ] [ RRC reference ]

Lin YF, Schulz AM, Pellegrino MW, Lu Y, Shaham S, Haynes CM.
Maintenance and propagation of a deleterious mitochondrial genome by the mitochondrial unfolded protein response.
Nature 2016 533(7603) 416-9 
[ PubMed ID = 27135930 ] [ RRC reference ]

Pellegrino MW, Nargund AM, Kirienko NV, Gillis R, Fiorese CJ, Haynes CM.
Mitochondrial UPR-regulated innate immunity provides resistance to pathogen infection.
Nature 2014 516(7531) 414-7 
[ PubMed ID = 25274306 ] [ RRC reference ]

Kaufman DM, Crowder CM.
Mitochondrial Proteostatic Collapse Leads to Hypoxic Injury.
Curr. Biol. 2015 25(16) 2171-6 
[ PubMed ID = 26234215 ] [ RRC reference ]