Mutants (Isolated)

tm4888

Allele Nametm4888
Sequence NameC40H1.6
CGC NameC40H1.6
Worm BaseAllele Name tm4888
CGC Name C40H1.6
Sequence C40H1.6
Phenotypehomozygous viable.
Mutation site23060/23061-23473/23474 (413 bp deletion)
ChromosomeIII
Putative gene structurejoin(22739..22834, 22884..22948, 23054..23213, 23259..23426)
Map position0.41
Balancer
Map position of balancer
Sequence of primersExtFwd:CGTACCGTCACTTGGTGTAA,IntFwd:AACACCACCACGTCGGAATG,ExtRev:GGGTATCAATGACTGTCACA,IntRev:TGTATCTCGCATTCGTCATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hertel P, Daniel J, Stegehake D, Vaupel H, Kailayangiri S, Gruel C, Woltersdorf C, Liebau E.
The ubiquitin-fold modifier 1 (Ufm1) cascade of Caenorhabditis elegans.
J Biol Chem 2013 288(15) 10661-71 
[ PubMed ID = 23449979 ] [ RRC reference ]

Chen C, Itakura E, Weber KP, Hegde RS, de Bono M.
An ER complex of ODR-4 and ODR-8/Ufm1 specific protease 2 promotes GPCR maturation by a Ufm1-independent mechanism.
PLoS Genet 2014 10(3) e1004082 
[ PubMed ID = 24603482 ] [ RRC reference ]