Home > Mutants (Isolated) > tm4876

Mutants (Isolated)

Allele Name		tm4876
Allele Type		Normal
Sequence Name		Y113G7B.16
Gene Name		Y113G7B.16
Worm Base	Allele Name	tm4876
	Gene Name	Y113G7B.16
	Sequence	Y113G7B.16
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		84044/84045 -TCAGGCCTC-84669/84670 (625 bp deletion + 9 bp insertion)
Chromosome		V
Putative gene structure		join(82485..82530, 82582..82713, 84222..85257, 87701..87956)
Map position		24.98
Balancer
Map position of balancer
Sequence of primers		IntRev:GCAAACGCACTGCGGAGATC,IntFwd:GTGTTAGCAGCGCCCCAAAT,ExtRev:GAATAGCAGCGCCCAAATCT,ExtFwd:TGCGGCGAAAACCGACTATA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Colin E, Daniel J, Ziegler A, Wakim J, Scrivo A, Haack TB, Khiati S, Denommé AS, Amati-Bonneau P, Charif M, Procaccio V, Reynier P, Aleck KA, Botto LD, Herper CL, Kaiser CS, Nabbout R, N'Guyen S, Mora-Lorca JA, Assmann B, Christ S, Meitinger T, Strom TM, Prokisch H, FREX Consortium, Miranda-Vizuete A, Hoffmann GF, Lenaers G, Bomont P, Liebau E, Bonneau D. Biallelic Variants in UBA5 Reveal that Disruption of the UFM1 Cascade Can Result in Early-Onset Encephalopathy. Am J Hum Genet 2016 99(3) 695-703  [ PubMed ID = 27545681 ] [ RRC reference ]