Mutants (Isolated)

tm4845

Allele Nametm4845
Sequence NameZK177.2
CGC NameZK177.2
Worm BaseAllele Name tm4845
CGC Name ZK177.2
Sequence ZK177.2
Phenotypehomozygous viable.
Mutation site17936/17937-AAAA-18148/18149 (212 bp deletion + 4 bp insertion)
ChromosomeII
Putative gene structurejoin(17797..18496, 18547..18635, 18679..18780)
Map position-1.24
Balancer
Map position of balancer
Sequence of primersExtFwd:GCACGAGCAACCAAACCCGA,ExtRev:GTGATACACCGTCTGTAGTC,IntFwd:AACCCGAGTCTAGTATGGAG,IntRev:GCTGGTTCTCCAATCGGCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liachko NF, McMillan PJ, Guthrie CR, Bird TD, Leverenz JB, Kraemer BC.
CDC7 inhibition blocks pathological TDP-43 phosphorylation and neurodegeneration.
Ann. Neurol. 2013 74(1) 39-52 
[ PubMed ID = 23424178 ] [ RRC reference ]