Home > Mutants (Isolated) > tm4796

Mutants (Isolated)

Allele Name		tm4796
Sequence Name		Y57G11C.37
CGC Name		Y57G11C.37
Worm Base	Allele Name	tm4796
	CGC Name	Y57G11C.37
	Sequence	Y57G11C.37
Phenotype		homozygous viable.
Mutation site		33546/33547-TTTTTTTTTTTTTTCC-34207/34208 (661 bp deletion + 16 bp insertion)
Chromosome		IV
Putative gene structure		join(26979..27130, 28669..29038, 29876..30034, 31349..31595, 32456..32543, 32591..32712, 32759..32889, 33925..34590, 36558..36788, 37500..37718)
Map position		12.32
Balancer
Map position of balancer
Sequence of primers		IntFwd:CCGTTGTGTGATTTCATAGC,ExtFwd:GTCGATTTTAGCTTCCGTGG,IntRev:ACGTTATCCATGCAACAGTC,ExtRev:GCTTACGGCCCACTTTCTAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Wang Y, Alam T, Hill-Harfe K, Lopez AJ, Leung CK, Iribarne D, Bruggeman B, Miyamoto MM, Harfe BD, Choe KP. Phylogenetic, expression, and functional analyses of anoctamin homologs in Caenorhabditis elegans. Am J Physiol Regul Integr Comp Physiol 2013 305(11) R1376-89  [ PubMed ID = 24049119 ] [ RRC reference ] Kim KW, Tang NH, Piggott CA, Andrusiak MG, Park S, Zhu M, Kurup N, Cherra SJ 3rd, Wu Z, Chisholm AD, Jin Y. Expanded genetic screening in Caenorhabditis elegans identifies new regulators and an inhibitory role for NAD+ in axon regeneration. Elife 2018 7   [ PubMed ID = 30461420 ] [ RRC reference ]