Mutants (Isolated)

tm4796

Allele Nametm4796
Sequence NameY57G11C.37
CGC NameY57G11C.37
Worm BaseAllele Name tm4796
CGC Name Y57G11C.37
Sequence Y57G11C.37
Phenotypehomozygous viable.
Mutation site33546/33547-TTTTTTTTTTTTTTCC-34207/34208 (661 bp deletion + 16 bp insertion)
ChromosomeIV
Putative gene structurejoin(26979..27130, 28669..29038, 29876..30034, 31349..31595, 32456..32543, 32591..32712, 32759..32889, 33925..34590, 36558..36788, 37500..37718)
Map position12.32
Balancer
Map position of balancer
Sequence of primersIntFwd:CCGTTGTGTGATTTCATAGC,ExtFwd:GTCGATTTTAGCTTCCGTGG,IntRev:ACGTTATCCATGCAACAGTC,ExtRev:GCTTACGGCCCACTTTCTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang Y, Alam T, Hill-Harfe K, Lopez AJ, Leung CK, Iribarne D, Bruggeman B, Miyamoto MM, Harfe BD, Choe KP.
Phylogenetic, expression, and functional analyses of anoctamin homologs in Caenorhabditis elegans.
Am J Physiol Regul Integr Comp Physiol 2013 305(11) R1376-89 
[ PubMed ID = 24049119 ] [ RRC reference ]

Kim KW, Tang NH, Piggott CA, Andrusiak MG, Park S, Zhu M, Kurup N, Cherra SJ 3rd, Wu Z, Chisholm AD, Jin Y.
Expanded genetic screening in Caenorhabditis elegans identifies new regulators and an inhibitory role for NAD+ in axon regeneration.
Elife 2018 7  
[ PubMed ID = 30461420 ] [ RRC reference ]