Mutants (Isolated)

tm4795

Allele Nametm4795
Sequence NameC01G8.9
CGC Namelet-526
Worm BaseAllele Name tm4795
CGC Name let-526
Sequence C01G8.9
PhenotypeLet or Ste.
Mutation site30688/30689-31448/31449 (760 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(29275..29412, 29808..30154, 30204..30315, 30366..30675, 30792..31855, 31948..32588, 32758..33954, 36596..36995, 37057..37247, 37570..38335, 38413..38421))
Map position-0.15
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:CGAAGGGCAGCCATTCCATG,ExtRev:GCTGCAGGATCCAATGGGAA,IntFwd:GAATGAGATGGGCTATGGCA,IntRev:CCAATGGGAAGCAACCGAGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Large EE, Mathies LD.
Caenorhabditis elegans SWI/SNF subunits control sequential developmental stages in the somatic gonad.
G3 (Bethesda) 2014 4(3) 471-83 
[ PubMed ID = 24402584 ] [ RRC reference ]