Mutants (Isolated)

tm478

Allele Nametm478
Sequence NameZK328.6
CGC NameZK328.6
Worm BaseAllele Name tm478
CGC Name ZK328.6
Sequence ZK328.6
Phenotypehomozygous viable
Mutation site31427/31428-AATTTTTGAAGCACGGTGGGCAAAAAATCCTTCAAAGAGGAATGGTCTCCATCACTTGATACATTTACATGTGCCCTTGTAATATCTCCACTAGTTTCTCATATGAAACAAACTACAACTGCTTTTGATAAAACTTTTGAGCAAACTGAATTGTTGTACAAGGAGGAAGTTAATTTTTTGAAAAGAGAAAAATTGGAGAGAACGCAAGAGCTAAAAATGGAAACGAAGAGACGAGATAAAGCTTTGCGAATTCAGAATAGAAAAAATGGATTGGCAAATAAAGAAATTACAGAAGGAGATGAAGAAGATGAGAGCTCGAAACTAGGTAATTAGATCTTTTTGTTTTTTTTTTGCTGTGGATTTTTATTTTTTCGAAATCATGTGAGCAAAACAAAACACTTAAAAAACACAAATTTTTAAAGATTATGATAGCCTGTCGTTAAATGAGAAGCTCA-33079/33080 (1652 bp deletion +455 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(27732..28052, 28381..28527, 28577..28844, 29230..29362, 31566..31632, 31784..32123, 32171..32457, 32645..32935, 32980..33120))
Map position-1.43
Balancer
Map position of balancer
Sequence of primersExtFwd:AGACGGAAAGATGCACCCTG,ExtRev:GAAGGGGGAAATCGGTTTCG,IntFwd:CCTGGACTGGAGCTATCAAT,IntRev:TGAGTGGATCGGCGATGCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Smith PA, Mango SE.
Role of T-box gene tbx-2 for anterior foregut muscle development in C. elegans.
Dev. Biol. 2007 302(1) 25-39 
[ PubMed ID = 17005176 ] [ RRC reference ]