Mutants (Isolated)

tm475

Allele Nametm475
Sequence NameC50F2.6
CGC Namefkb-5
Worm BaseAllele Name tm475
CGC Name fkb-5
Sequence C50F2.6
Phenotypehomozygous viable. Dr. A.P. Page: J. Biol. Chem. 282, 12813 (2007).
Mutation site21670/21671-22116/22117 (446 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(21880..22059, 22337..22727, 22826..23049))
Map position-1.93
Balancer
Map position of balancer
Sequence of primersIntRev:GAGGATGTACGAGGAGGCAA,ExtRev:GGGATTTCGCAGTAGGAGGA,ExtFwd:AGAGCTCCCGTTTTGCAGGA,IntFwd:TTTTACTTCAGGGTGGCCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Winter AD, Eschenlauer SC, McCormack G, Page AP.
Loss of secretory pathway FK506-binding proteins results in cold-sensitive lethality and associate extracellular matrix defects in the nematode Caenorhabditis elegans.
J. Biol. Chem. 2007 282(17) 12813-21 
[ PubMed ID = 17339317 ] [ RRC reference ]