Mutants (Isolated)

tm4719

Allele Nametm4719
Sequence NameE01A2.4
CGC NameE01A2.4
Worm BaseAllele Name tm4719
CGC Name E01A2.4
Sequence E01A2.4
PhenotypeLet or Ste.
Mutation site5921/5922-6364/6365 (443 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(4820..4942, 5743..7000, 7192..7253, 7311..7382))
Map position-1.68
Balancer
Map position of balancer
Sequence of primersIntFwd:TCTCGTCGCCTCCATTGCCT,IntRev:ACGAATAGTGGCAGCGGGGA,ExtFwd:GCACCCTTGCTTGGGCCATA,ExtRev:GAGAGAGGTACTTTGCCGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chu JS, Johnsen RC, Chua SY, Tu D, Dennison M, Marra M, Jones SJ, Baillie DL, Rose AM.
Allelic ratios and the mutational landscape reveal biologically significant heterozygous SNVs.
Genetics 2012 190(4) 1225-33 
[ PubMed ID = 22267497 ] [ RRC reference ]