Mutants (Isolated)

tm4718

Allele Nametm4718
Sequence NameY17G7B.13
CGC NameY17G7B.13
Worm BaseAllele Name tm4718
CGC Name Y17G7B.13
Sequence Y17G7B.13
Phenotypelethal or sterile.
Mutation site76425/76426-G-77081/77082 (656 bp deletion + 1 bp insertion)
ChromosomeII
Putative gene structurejoin(74190..74213, 74274..74371, 75318..75705, 76881..76961, 77087..77335, 78085..78237, 78418..78552, 78981..79028, 79145..79204)
Map position5.99
BalancermIn1
Map position of balancer
Sequence of primersIntFwd:CGCCGAAGGTATGTGTGTAT,ExtFwd:CTAGACGGGGCATTAAAATC,IntRev:TCCTCCGACGTAGCATCATG,ExtRev:CTCACCGCCGAAATAAGATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lowry J, Yochem J, Chuang CH, Sugioka K, Connolly AA, Bowerman B.
High-Throughput Cloning of Temperature-Sensitive Caenorhabditis elegans Mutants with Adult Syncytial Germline Membrane Architecture Defects.
G3 (Bethesda) 2015 5(11) 2241-55 
[ PubMed ID = 26311651 ] [ RRC reference ]