Allele Name | tm470 |
Allele Type | 通常株 |
Sequence Name | B0222.4 |
Gene Name | tag-38 |
Worm Base | Allele Name |
tm470
|
Gene Name |
tag-38
|
Sequence |
B0222.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 12237/12238-13480/13481 (1243 bp deletion) |
Chromosome | V |
Putative gene structure | complement(join(12211..12436, 12496..13230, 13335..13780, 13842..13915, 14203..14350)) |
Map position | 1.95 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:CAACGACTACGTGACAGAAA,IntRev:ACAGGCATCCGGAAACGTTT,IntFwd:CGCATTCGAGGGTAATTGAA,ExtRev:GGCACAATGATCACCAAGTA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Zhi L, Yu Y, Li X, Wang D, Wang D. Molecular Control of Innate Immune Response to Pseudomonas aeruginosa Infection by Intestinal let-7 in Caenorhabditis elegans. PLoS Pathog 2017 13(1) e1006152
[ PubMed ID = 28095464 ]
[ RRC reference ]
|
Deng X, Yin X, Allan R, Lu DD, Maurer CW, Haimovitz-Friedman A, Fuks Z, Shaham S, Kolesnick R. Ceramide biogenesis is required for radiation-induced apoptosis in the germ line of C. elegans. Science 2008 322(5898) 110-5
[ PubMed ID = 18832646 ]
[ RRC reference ]
|
|