Mutants (Isolated)

tm469

Allele Nametm469
Sequence NameF29B9.4
CGC Namepsr-1
Worm BaseAllele Name tm469
CGC Name psr-1
Sequence F29B9.4
Phenotypehomozygous viable, Dr. D. Xue (Science 302, 1563, 2003), Dr. J. Ewbank: normal induction of nlp-29 after infection by D. coniospora.
Mutation site7569/7570-8537/8538 (968 bp deletion)
ChromosomeIV
Putative gene structurejoin(7527..7684, 7740..7860, 8898..9424, 9604..9847)
Map position0.56
Balancer
Map position of balancer
Sequence of primersExtFwd:TTCACTCCGAAGCTAGTTGT,IntRev:TTTTCGTCCACCACATCGCC,ExtRev:GTGCTCATTTTCTCCGGACA,IntFwd:ACACCCTTCAGCGCTTCTAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Züllig S, Neukomm LJ, Jovanovic M, Charette SJ, Lyssenko NN, Halleck MS, Reutelingsperger CP, Schlegel RA, Hengartner MO.
Aminophospholipid translocase TAT-1 promotes phosphatidylserine exposure during C. elegans apoptosis.
Curr. Biol. 2007 17(11) 994-9 
[ PubMed ID = 17540571 ] [ RRC reference ]

Lu Q, Zhang Y, Hu T, Guo P, Li W, Wang X.
C. elegans Rab GTPase 2 is required for the degradation of apoptotic cells.
Development 2008 135(6) 1069-80 
[ PubMed ID = 18256195 ] [ RRC reference ]

Wang X, Wu YC, Fadok VA, Lee MC, Gengyo-Ando K, Cheng LC, Ledwich D, Hsu PK, Chen JY, Chou BK, Henson P, Mitani S, Xue D.
Cell corpse engulfment mediated by C. elegans phosphatidylserine receptor through CED-5 and CED-12.
Science 2003 302(5650) 1563-6 
[ PubMed ID = 14645848 ] [ RRC reference ]

Yang H, Chen YZ, Zhang Y, Wang X, Zhao X, Godfroy JI 3rd, Liang Q, Zhang M, Zhang T, Yuan Q, Ann Royal M, Driscoll M, Xia NS, Yin H, Xue D.
A lysine-rich motif in the phosphatidylserine receptor PSR-1 mediates recognition and removal of apoptotic cells.
Nat Commun 2015 6 5717 
[ PubMed ID = 25564762 ] [ RRC reference ]

Neumann B, Coakley S, Giordano-Santini R, Linton C, Lee ES, Nakagawa A, Xue D, Hilliard MA.
EFF-1-mediated regenerative axonal fusion requires components of the apoptotic pathway.
Nature 2015 517(7533) 219-22 
[ PubMed ID = 25567286 ] [ RRC reference ]

Wang X, Li W, Zhao D, Liu B, Shi Y, Chen B, Yang H, Guo P, Geng X, Shang Z, Peden E, Kage-Nakadai E, Mitani S, Xue D.
Caenorhabditis elegans transthyretin-like protein TTR-52 mediates recognition of apoptotic cells by the CED-1 phagocyte receptor.
Nat. Cell Biol. 2010 12(7) 655-64 
[ PubMed ID = 20526330 ] [ RRC reference ]

Cabello J, Neukomm LJ, Günesdogan U, Burkart K, Charette SJ, Lochnit G, Hengartner MO, Schnabel R.
The Wnt pathway controls cell death engulfment, spindle orientation, and migration through CED-10/Rac.
PLoS Biol. 2010 8(2) e1000297 
[ PubMed ID = 20126385 ] [ RRC reference ]

Hsu TY, Wu YC.
Engulfment of apoptotic cells in C. elegans is mediated by integrin alpha/SRC signaling.
Curr. Biol. 2010 20(6) 477-86 
[ PubMed ID = 20226672 ] [ RRC reference ]

Darland-Ransom M, Wang X, Sun CL, Mapes J, Gengyo-Ando K, Mitani S, Xue D.
Role of C. elegans TAT-1 protein in maintaining plasma membrane phosphatidylserine asymmetry.
Science 2008 320(5875) 528-31 
[ PubMed ID = 18436785 ] [ RRC reference ]

Basu A, Dey S, Puri D, Das Saha N, Sabharwal V, Thyagarajan P, Srivastava P, Koushika SP, Ghosh-Roy A.
let-7 miRNA controls CED-7 homotypic adhesion and EFF-1-mediated axonal self-fusion to restore touch sensation following injury.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(47) E10206-E10215 
[ PubMed ID = 29109254 ] [ RRC reference ]

Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D.
C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1.
Nat. Cell Biol. 2007 9(5) 541-9 
[ PubMed ID = 17401362 ] [ RRC reference ]