Mutants (Isolated)

tm467

Allele Nametm467
Sequence NameK08F8.2
CGC Nameatf-2
Worm BaseAllele Name tm467
CGC Name atf-2
Sequence K08F8.2
Phenotypehomozygous viable. Dr. K. Matsumoto: no copper sensitivity.
Mutation site14941/14932-TT-15616/15617 (675 bp deletion, 2 bp insertion)
ChromosomeII
Putative gene structurejoin(14261..14391, 14466..14841, 15072..15294, 15377..15633, 15707..15805, 15894..16013)
Map position0.87
Balancer
Map position of balancer
Sequence of primersExtFwd:AAAGTCGGCATCATCATGGA,IntRev:ATTTATGACATTCCGCCACC,ExtRev:GGCCTGAATGCCTTCTATTT,IntFwd:AAATGATTAGGAGACGGGTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Erdélyi P, Borsos E, Takács-Vellai K, Kovács T, Kovács AL, Sigmond T, Hargitai B, Pásztor L, Sengupta T, Dengg M, Pécsi I, Tóth J, Nilsen H, Vértessy BG, Vellai T.
Shared developmental roles and transcriptional control of autophagy and apoptosis in Caenorhabditis elegans.
J. Cell. Sci. 2011 124(Pt 9) 1510-8 
[ PubMed ID = 21502138 ] [ RRC reference ]

Janssen T, Husson SJ, Meelkop E, Temmerman L, Lindemans M, Verstraelen K, Rademakers S, Mertens I, Nitabach M, Jansen G, Schoofs L.
Discovery and characterization of a conserved pigment dispersing factor-like neuropeptide pathway in Caenorhabditis elegans.
J. Neurochem. 2009 111(1) 228-41 
[ PubMed ID = 19686386 ] [ RRC reference ]