Mutants (Isolated)

tm465

Allele Nametm465
Sequence NameC09H6.1
CGC Namespr-4
Worm BaseAllele Name tm465
CGC Name spr-4
Sequence C09H6.1
Phenotypehomozygous viable
Mutation site6842/6843-8272/8273 (1430 bp deletion)
ChromosomeI
Putative gene structurejoin(5931..6251, 6295..7275, 7333..7464, 8101..8357, 8460..9826, 9922..10583, 11058..11267)
Map position2.53
Balancer
Map position of balancer
Sequence of primersIntFwd:TACGGCGCTCGAAACGAAAG,ExtRev:ACCAGAGTTGGATGGACTTG,ExtFwd:TTCAATCGAGTCGGACAATC,IntRev:TTGGAGAGAGACGATTCTTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Lu T, Aron L, Zullo J, Pan Y, Kim H, Chen Y, Yang TH, Kim HM, Drake D, Liu XS, Bennett DA, Colaiácovo MP, Yankner BA.
REST and stress resistance in ageing and Alzheimer's disease.
Nature 2014 507(7493) 448-54 
[ PubMed ID = 24670762 ] [ RRC reference ]