Mutants (Isolated)

tm4634

Allele Nametm4634
Sequence NameY34D9A.6
CGC Nameglrx-10
Worm BaseAllele Name tm4634
CGC Name glrx-10
Sequence Y34D9A.6
Phenotypehomozygous viable.
Mutation site31458/31459-ACACACACGATTCG-31787/31788 (329 bp deletion + 14 bp insertion)
ChromosomeI
Putative gene structurejoin(31479..31562, 32281..32514)
Map position-17.27
Balancer
Map position of balancer
Sequence of primersExtRev:GGCAGCCGATTGTCAATGGA,IntRev:TGCCAGAACCCCGTGACAGA,ExtFwd:CCGCACGGCGGTAATTTCGA,IntFwd:TCCCGAATTTTCCTCGCCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Johnson WM, Yao C, Siedlak SL, Wang W, Zhu X, Caldwell GA, Wilson-Delfosse AL, Mieyal JJ, Chen SG.
Glutaredoxin deficiency exacerbates neurodegeneration in C. elegans models of Parkinson's disease.
Hum. Mol. Genet. 2015 24(5) 1322-35 
[ PubMed ID = 25355420 ] [ RRC reference ]