Mutants (Isolated)

tm4634

Allele Nametm4634
Sequence NameY34D9A.6
CGC Nameglrx-10
Worm BaseAllele Name tm4634
CGC Name glrx-10
Sequence Y34D9A.6
Phenotypehomozygous viable.
Mutation site31458/31459-ACACACACGATTCG-31787/31788 (329 bp deletion + 14 bp insertion)
ChromosomeI
Putative gene structurejoin(31479..31562, 32281..32514)
Map position-17.27
Balancer
Map position of balancer
Sequence of primersExtRev:GGCAGCCGATTGTCAATGGA,IntRev:TGCCAGAACCCCGTGACAGA,ExtFwd:CCGCACGGCGGTAATTTCGA,IntFwd:TCCCGAATTTTCCTCGCCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Johnson WM, Golczak M, Choe K, Curran PL, Miller OG, Yao C, Wang W, Lin J, Milkovic NM, Ray A, Ravindranath V, Zhu X, Wilson MA, Wilson-Delfosse AL, Chen SG, Mieyal JJ.
Regulation of DJ-1 by Glutaredoxin 1 in Vivo: Implications for Parkinson's Disease.
Biochemistry 2016 55(32) 4519-32 
[ PubMed ID = 26894491 ] [ RRC reference ]

Johnson WM, Yao C, Siedlak SL, Wang W, Zhu X, Caldwell GA, Wilson-Delfosse AL, Mieyal JJ, Chen SG.
Glutaredoxin deficiency exacerbates neurodegeneration in C. elegans models of Parkinson's disease.
Hum Mol Genet 2015 24(5) 1322-35 
[ PubMed ID = 25355420 ] [ RRC reference ]