Allele Name | tm463 |
Sequence Name | B0286.2 |
CGC Name | lat-2 |
Worm Base | Allele Name |
tm463
|
CGC Name |
lat-2
|
Sequence |
B0286.2
|
Phenotype | homozygous viable. Dr. Y-K. Paik: dauer formed on daumone plate. Dr. M. Peter: does not suppress par-2 (RNAi). |
Mutation site | 2402/2403-3780/3781 (1378 bp deletion) |
Chromosome | II |
Putative gene structure | join(1681..1771, 1817..1972, 2391..2674, 3380..3489, 3535..3732, 4020..4217, 4667..4725, 5122..5347, 5724..6049, 6139..6226, 6598..7038, 7540..7617, 8073..8296, 8610..8853, 8900..9764, 10463..10690, 10844..11033, 11079..11206, 11298..11513) |
Map position | -4.8 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:GGCAGACGTTTTTGTGACTA,IntFwd:CGTAGGGCTTACCTTTTAGA,IntRev:CGAGACGGACTAAGTATTAG,ExtRev:AACGGAATGAATGCGCAACC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Guest M, Bull K, Walker RJ, Amliwala K, O'Connor V, Harder A, Holden-Dye L, Hopper NA. The calcium-activated potassium channel, SLO-1, is required for the action of the novel cyclo-octadepsipeptide anthelmintic, emodepside, in Caenorhabditis elegans. Int J Parasitol 2007 37(14) 1577-88
[ PubMed ID = 17583712 ]
[ RRC reference ]
|
Langenhan T, Prömel S, Mestek L, Esmaeili B, Waller-Evans H, Hennig C, Kohara Y, Avery L, Vakonakis I, Schnabel R, Russ AP. Latrophilin signaling links anterior-posterior tissue polarity and oriented cell divisions in the C. elegans embryo. Dev Cell 2009 17(4) 494-504
[ PubMed ID = 19853563 ]
[ RRC reference ]
|
Labbé JC, Pacquelet A, Marty T, Gotta M. A genomewide screen for suppressors of par-2 uncovers potential regulators of PAR protein-dependent cell polarity in Caenorhabditis elegans. Genetics 2006 174(1) 285-95
[ PubMed ID = 16816419 ]
[ RRC reference ]
|
|