Mutants (Isolated)

tm463

Allele Nametm463
Sequence NameB0286.2
CGC Namelat-2
Worm BaseAllele Name tm463
CGC Name lat-2
Sequence B0286.2
Phenotypehomozygous viable. Dr. Y-K. Paik: dauer formed on daumone plate. Dr. M. Peter: does not suppress par-2 (RNAi).
Mutation site2402/2403-3780/3781 (1378 bp deletion)
ChromosomeII
Putative gene structurejoin(1681..1771, 1817..1972, 2391..2674, 3380..3489, 3535..3732, 4020..4217, 4667..4725, 5122..5347, 5724..6049, 6139..6226, 6598..7038, 7540..7617, 8073..8296, 8610..8853, 8900..9764, 10463..10690, 10844..11033, 11079..11206, 11298..11513)
Map position-4.8
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCAGACGTTTTTGTGACTA,IntFwd:CGTAGGGCTTACCTTTTAGA,IntRev:CGAGACGGACTAAGTATTAG,ExtRev:AACGGAATGAATGCGCAACC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Guest M, Bull K, Walker RJ, Amliwala K, O'Connor V, Harder A, Holden-Dye L, Hopper NA.
The calcium-activated potassium channel, SLO-1, is required for the action of the novel cyclo-octadepsipeptide anthelmintic, emodepside, in Caenorhabditis elegans.
Int. J. Parasitol. 2007 37(14) 1577-88 
[ PubMed ID = 17583712 ] [ RRC reference ]

Langenhan T, Prömel S, Mestek L, Esmaeili B, Waller-Evans H, Hennig C, Kohara Y, Avery L, Vakonakis I, Schnabel R, Russ AP.
Latrophilin signaling links anterior-posterior tissue polarity and oriented cell divisions in the C. elegans embryo.
Dev. Cell 2009 17(4) 494-504 
[ PubMed ID = 19853563 ] [ RRC reference ]

Labbé JC, Pacquelet A, Marty T, Gotta M.
A genomewide screen for suppressors of par-2 uncovers potential regulators of PAR protein-dependent cell polarity in Caenorhabditis elegans.
Genetics 2006 174(1) 285-95 
[ PubMed ID = 16816419 ] [ RRC reference ]