Mutants (Isolated)

tm4613

Allele Nametm4613
Sequence NameY53F4B.3
CGC NameY53F4B.3
Worm BaseAllele Name tm4613
CGC Name Y53F4B.3
Sequence Y53F4B.3
Phenotypehomozygous viable.
Mutation site17466/17467-TTTCCCTGAAAAAAAAGTGA-18173/18174 (707 bp deletion + 20 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(17553..17809, 17859..17943, 18000..18197))
Map position23.84
Balancer
Map position of balancer
Sequence of primersIntFwd:ATTCCGAAGGACCTTCCTGA,ExtFwd:CACGCGAAACCGGTCTCAAC,IntRev:GTGTTTGCGTCCAGAGCGGA,ExtRev:CGTCTGCCTTTGCGCGTGAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Meier B, Volkova NV, Hong Y, Schofield P, Campbell PJ, Gerstung M, Gartner A.
Mutational signatures of DNA mismatch repair deficiency in C. elegans and human cancers.
Genome Res 2018 28(5) 666-675 
[ PubMed ID = 29636374 ] [ RRC reference ]