Mutants (Isolated)

tm4607

Allele Nametm4607
Sequence NameY53C10A.3
CGC NameY53C10A.3
Worm BaseAllele Name tm4607
CGC Name Y53C10A.3
Sequence Y53C10A.3
Phenotypehomozygous viable.
Mutation site17483/17484-17757/17758 (274 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(16631..16713, 16865..17008, 17196..17409, 17458..17542, 18991..19076, 19129..19476))
Map position13.02
Balancer
Map position of balancer
Sequence of primersIntRev:CATGGCGCATTGTATGCATG,IntFwd:ATGAAGCCCGTGGGGATCTG,ExtRev:GACGTATGCGTCTCTTCTCC,ExtFwd:GAGTAGAGGAGTCCGGAATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Barna J, Princz A, Kosztelnik M, Hargitai B, Takács-Vellai K, Vellai T.
Heat shock factor-1 intertwines insulin/IGF-1, TGF-β and cGMP signaling to control development and aging.
BMC Dev. Biol. 2012 12 32 
[ PubMed ID = 23116063 ] [ RRC reference ]