Mutants (Isolated)

tm4586

Allele Nametm4586
Sequence NameY74C9A.4
CGC Namercor-1
Worm BaseAllele Name tm4586
CGC Name rcor-1
Sequence Y74C9A.4
Phenotypehomozygous viable.
Mutation site24859/24860-25354/25355 (495 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(17851..17898, 17946..18055, 18955..19181, 20211..20418, 20788..20904, 20953..21079, 24591..24785, 24869..25030, 25213..25412, 26311..26464, 26530..26621, 26673..26718))
Map position-21.51
Balancer
Map position of balancer
Sequence of primersExtFwd:ATTGCAGCCGCGGGACTAGT,IntFwd:CGTTCGCCGTGCCGTGTATT,ExtRev:ATCTAATCCACGTGGGAACC,IntRev:GGGAACCGAATATCAGGCGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Vandamme J, Sidoli S, Mariani L, Friis C, Christensen J, Helin K, Jensen ON, Salcini AE.
H3K23me2 is a new heterochromatic mark in Caenorhabditis elegans.
Nucleic Acids Res. 2015 43(20) 9694-710 
[ PubMed ID = 26476455 ] [ RRC reference ]