Allele Name | tm458 |
Sequence Name | F31A3.2 |
CGC Name | hlh-28 |
Worm Base | Allele Name |
tm458
|
CGC Name |
hlh-28
|
Sequence |
F31A3.2
|
Phenotype | homozygous viable. Dr. R. Lin, Dr. M. Maduro: normal cell division during 8-30 cell stage. Dr. P. Sengupta: normal dye-filling into sensory neurons. Dr. J. Priess: Dev. Cell 8, 867-879 (2005). Dr. C.M. Johnson: BBA 1769, 5 (2007). |
Mutation site | 19745/19746-21019/21020 (1274 bp deletion) |
Chromosome | X |
Putative gene structure | join(18012..18080, 19345..19514, 19567..19791, 19841..20165) |
Map position | 24.35 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:GACGTAAGCCGGAAGGAGTT,IntRev:TTTTAACACCGACGACAACG,IntFwd:CGCGAGCCTTGTCATGGGAA,ExtFwd:TCCTATGCCACGCTTAATAG |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Lanjuin A, Claggett J, Shibuya M, Hunter CP, Sengupta P. Regulation of neuronal lineage decisions by the HES-related bHLH protein REF-1. Dev. Biol. 2006 290(1) 139-51
[ PubMed ID = 16376329 ]
[ RRC reference ]
|
McMiller TL, Sims D, Lee T, Williams T, Johnson CM. Molecular characterization of the Caenorhabditis elegans REF-1 family member, hlh-29/hlh-28. Biochim. Biophys. Acta 2007 1769(1) 5-19
[ PubMed ID = 17258327 ]
[ RRC reference ]
|
Neves A, Priess JR. The REF-1 family of bHLH transcription factors pattern C. elegans embryos through Notch-dependent and Notch-independent pathways. Dev. Cell 2005 8(6) 867-79
[ PubMed ID = 15935776 ]
[ RRC reference ]
|
|