Mutants (Isolated)

tm458

Allele Nametm458
Sequence NameF31A3.2
CGC Namehlh-28
Worm BaseAllele Name tm458
CGC Name hlh-28
Sequence F31A3.2
Phenotypehomozygous viable. Dr. R. Lin, Dr. M. Maduro: normal cell division during 8-30 cell stage. Dr. P. Sengupta: normal dye-filling into sensory neurons. Dr. J. Priess: Dev. Cell 8, 867-879 (2005). Dr. C.M. Johnson: BBA 1769, 5 (2007).
Mutation site19745/19746-21019/21020 (1274 bp deletion)
ChromosomeX
Putative gene structurejoin(18012..18080, 19345..19514, 19567..19791, 19841..20165)
Map position24.35
Balancer
Map position of balancer
Sequence of primersExtRev:GACGTAAGCCGGAAGGAGTT,IntRev:TTTTAACACCGACGACAACG,IntFwd:CGCGAGCCTTGTCATGGGAA,ExtFwd:TCCTATGCCACGCTTAATAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Lanjuin A, Claggett J, Shibuya M, Hunter CP, Sengupta P.
Regulation of neuronal lineage decisions by the HES-related bHLH protein REF-1.
Dev. Biol. 2006 290(1) 139-51 
[ PubMed ID = 16376329 ] [ RRC reference ]

McMiller TL, Sims D, Lee T, Williams T, Johnson CM.
Molecular characterization of the Caenorhabditis elegans REF-1 family member, hlh-29/hlh-28.
Biochim. Biophys. Acta 2007 1769(1) 5-19 
[ PubMed ID = 17258327 ] [ RRC reference ]

Neves A, Priess JR.
The REF-1 family of bHLH transcription factors pattern C. elegans embryos through Notch-dependent and Notch-independent pathways.
Dev. Cell 2005 8(6) 867-79 
[ PubMed ID = 15935776 ] [ RRC reference ]