Mutants (Isolated)

tm4575

Allele Nametm4575
Sequence NameF35G12.4
CGC NameF35G12.4
Worm BaseAllele Name tm4575
CGC Name F35G12.4
Sequence F35G12.4
Phenotypehomozygous viable.
Mutation site13455/13456-13921/13922 (466 bp deletion)
ChromosomeIII
Putative gene structurejoin(12675..12860, 12914..13040, 13092..13183, 13231..13425, 13472..13678, 13726..13913, 13958..14130, 14176..14282, 14333..14431, 14485..14578, 14633..14780, 14832..15023, 15073..15155, 15198..15358)
Map position-3.08
Balancer
Map position of balancer
Sequence of primersExtRev:CGTCTTTTGATGAAAGCCAC,IntRev:AGCGTCCAGCTCGTCCAAAG,ExtFwd:CGCGATGAGCACGAGTATTC,IntFwd:TCGTTCGGCTGTCAGTGCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dahlberg CL, Juo P.
The WD40-repeat proteins WDR-20 and WDR-48 bind and activate the deubiquitinating enzyme USP-46 to promote the abundance of the glutamate receptor GLR-1 in the ventral nerve cord of Caenorhabditis elegans.
J. Biol. Chem. 2014 289(6) 3444-56 
[ PubMed ID = 24356955 ] [ RRC reference ]