Mutants (Isolated)

tm4567

Allele Nametm4567
Sequence NameY113G7B.23
CGC Namepsa-1
Worm BaseAllele Name tm4567
CGC Name psa-1
Sequence Y113G7B.23
PhenotypeLet or Ste.
Mutation site59812/59813-GA-60051/60052 (239 bp deletion + 2 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(52227..52375, 53628..54593, 56606..57026, 58408..58500, 59492..60117, 61714..61828))
Map position24.97
Balancer
Map position of balancer
Sequence of primersIntRev:AAGACGCCGAATTCAGCGCA,ExtFwd:AGACGCCAGGTACGCACTCT,IntFwd:GTACGCACTCTCATCGCGAT,ExtRev:TGCTAATCCAATTTCCCCTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ruijtenberg S, van den Heuvel S.
G1/S Inhibitors and the SWI/SNF Complex Control Cell-Cycle Exit during Muscle Differentiation.
Cell 2015 162(2) 300-313 
[ PubMed ID = 26144318 ] [ RRC reference ]

Large EE, Mathies LD.
Caenorhabditis elegans SWI/SNF subunits control sequential developmental stages in the somatic gonad.
G3 (Bethesda) 2014 4(3) 471-83 
[ PubMed ID = 24402584 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]