Mutants (Isolated)

tm4559

Allele Nametm4559
Sequence NameH22K11.1
CGC Nameasp-3
Worm BaseAllele Name tm4559
CGC Name asp-3
Sequence H22K11.1
Phenotypehomozygous viable.
Mutation site19550/19551-CCTT-19785/19786 (235 bp deletion + 4 bp insertion)
ChromosomeX
Putative gene structurejoin(19463..19521, 19602..19878, 19930..20034, 20088..20843)
Map position-2.43
Balancer
Map position of balancer
Sequence of primersExtRev:CCCATGAATCCAGAGAGGCA,IntRev:GGTGGATCCTCCGTTTCCGT,ExtFwd:GTCGCCTTGGCTTCTGCCAT,IntFwd:TTGGCTTCTGCCATCCAGAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication