Mutants (Isolated)

tm4559

Allele Nametm4559
Sequence NameH22K11.1
CGC Nameasp-3
Worm BaseAllele Name tm4559
CGC Name asp-3
Sequence H22K11.1
Phenotypehomozygous viable.
Mutation site19550/19551-CCTT-19785/19786 (235 bp deletion + 4 bp insertion)
ChromosomeX
Putative gene structurejoin(19463..19521, 19602..19878, 19930..20034, 20088..20843)
Map position-2.43
Balancer
Map position of balancer
Sequence of primersExtRev:CCCATGAATCCAGAGAGGCA,IntRev:GGTGGATCCTCCGTTTCCGT,ExtFwd:GTCGCCTTGGCTTCTGCCAT,IntFwd:TTGGCTTCTGCCATCCAGAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Geng X, Harry BL, Zhou Q, Skeen-Gaar RR, Ge X, Lee ES, Mitani S, Xue D.
Hepatitis B virus X protein targets the Bcl-2 protein CED-9 to induce intracellular Ca2+ increase and cell death in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(45) 18465-70 
[ PubMed ID = 23091037 ] [ RRC reference ]