Mutants (Isolated)

tm455

Allele Nametm455
Sequence NameF16H11.4
CGC Nameceh-1
Worm BaseAllele Name tm455
CGC Name ceh-1
Sequence F16H11.4
Phenotypehomozygous viable. Dr. J-C. Martinou: not hypersensitive nor hyperresistant to anoxia.
Mutation site7654/7655-8096/8097 (442 bp deletion)
ChromosomeX
Putative gene structurecomplement(join (7137..7253, 7307..7456, 7505..7573, 7621..7683))
Map position-7.05
Balancer
Map position of balancer
Sequence of primersExtRev:TCTTCAACTCCTCCGCAACT,IntRev:TAGAAGAAGCTCCGGTAGGC,ExtFwd:TCTCACTTTGATGTGAGCCG,IntFwd:ACTGCACTTTCATTGTGCGG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Fuxman Bass JI, Pons C, Kozlowski L, Reece-Hoyes JS, Shrestha S, Holdorf AD, Mori A, Myers CL, Walhout AJ.
A gene-centered C. elegans protein-DNA interaction network provides a framework for functional predictions.
Mol Syst Biol 2016 12(10) 884 
[ PubMed ID = 27777270 ] [ RRC reference ]