Mutants (Isolated)

tm4536

Allele Nametm4536
Sequence NameF09E5.5
CGC Namesec-6
Worm BaseAllele Name tm4536
CGC Name sec-6
Sequence F09E5.5
PhenotypeLet or Ste.
Mutation site20077/20078-20400/20401 (323 bp deletion)
ChromosomeII
Putative gene structurejoin(19705..19815, 19873..19985, 20033..20327, 20381..20476, 20824..20891, 21215..21521, 21573..21818, 22360..22452, 29277..29370, 29421..29491, 29955..30163, 31329..31553, 31605..31725, 31776..32117)
Map position-1.79
BalancermIn1 [mIs14]
Map position of balancer
Sequence of primersExtFwd:GTGACGATCGAAGGACAGAG,IntFwd:GAGCTTTGACGGACCTGCGA,ExtRev:CTCGACAGAACAGGACTATC,IntRev:ATAGCCTGTGCATTGATCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kumar H, Pushpa K, Kumari A, Verma K, Pergu R, Mylavarapu SVS.
The exocyst complex and Rab5 are required for abscission by localizing ESCRT III subunits to the cytokinetic bridge.
J Cell Sci 2019 132(14)  
[ PubMed ID = 31221728 ] [ RRC reference ]