Mutants (Isolated)

tm4533

Allele Nametm4533
Sequence NameT05B4.2
CGC Namenhr-57
Worm BaseAllele Name tm4533
CGC Name nhr-57
Sequence T05B4.2
Phenotypehomozygous viable.
Mutation site27306/27307-TT-27802/27803 (496 bp deletion + 2 bp insertion)
ChromosomeV
Putative gene structurejoin(26232..26314, 26984..27141, 27499..27605, 27653..27757, 27808..28109, 28164..28279, 28330..28484, 28913..29011)
Map position-6.73
Balancer
Map position of balancer
Sequence of primersIntRev:CCAGAATAAGCCTAAGCCTA,ExtRev:GGCCGCTTTATTGTGCCTTG,IntFwd:GCACGCCATGGCTGATTGTT,ExtFwd:CACGTCGGAATGAATCCGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Maxeiner S, Grolleman J, Schmid T, Kammenga J, Hajnal A.
The hypoxia-response pathway modulates RAS/MAPK-mediated cell fate decisions in Caenorhabditis elegans.
Life Sci Alliance 2019 2(3)  
[ PubMed ID = 31126994 ] [ RRC reference ]