Mutants (Isolated)

tm4526

Allele Nametm4526
Sequence NameF52D2.4
CGC Namegei-12
Worm BaseAllele Name tm4526
CGC Name gei-12
Sequence F52D2.4
Phenotypehomozygous viable.
Mutation site39908/39909-ATCAAGACTATCAAGAAGATCAA-40609/40610 (701 bp deletion + 23 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(38393..38718, 38767..39056, 39188..39322, 39371..39517, 39564..39674, 39721..41242, 41288..41345))
Map position-17.16
Balancer
Map position of balancer
Sequence of primersIntRev:GCGGTCTGCCAAACTCGAGA,IntFwd:CTTGCTGGATGATGTCAGAC,ExtFwd:AACCACGCCAAGTGACTTGT,ExtRev:AACCTTACCCAAGCGGTCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen JX, Cipriani PG, Mecenas D, Polanowska J, Piano F, Gunsalus KC, Selbach M.
In Vivo Interaction Proteomics in Caenorhabditis elegans Embryos Provides New Insights into P Granule Dynamics.
Mol Cell Proteomics 2016 15(5) 1642-57 
[ PubMed ID = 26912668 ] [ RRC reference ]