Mutants (Isolated)

tm4519

Allele Nametm4519
Sequence NameH04D03.1
CGC NameH04D03.1
Worm BaseAllele Name tm4519
CGC Name H04D03.1
Sequence H04D03.1
Phenotypelethal or sterile
Mutation site7000/7001-7403/7404 (403 bp deletion)
ChromosomeIII
Putative gene structurejoin(6736..6795, 6854..7195, 7310..7522)
Map position2.5
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtRev:CGTGGCTTGTCCACAGTGAC,IntFwd:TAGTCCCTGCCCCTACTCAC,ExtFwd:GCGGTGGTTGCGAAATAGTC,IntRev:TCTCGCTTCCGGTCCTTAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yee CS, Sybingco SS, Serdetchania V, Kholkina G, Bueno de Mesquita M, Naqvi Z, Park SH, Lam K, Killeen MT.
ENU-3 is a novel motor axon outgrowth and guidance protein in C. elegans.
Dev Biol 2011 352(2) 243-53 
[ PubMed ID = 21295567 ] [ RRC reference ]

Yee C, Florica R, Fillingham J, Killeen MT.
ENU-3 functions in an UNC-6/netrin dependent pathway parallel to UNC-40/DCC/frazzled for outgrowth and guidance of the touch receptor neurons in C. elegans.
Dev Dyn 2014 243(3) 459-67 
[ PubMed ID = 24123761 ] [ RRC reference ]

Florica RO, Hipolito V, Bautista S, Anvari H, Rapp C, El-Rass S, Asgharian A, Antonescu CN, Killeen MT.
The ENU-3 protein family members function in the Wnt pathway parallel to UNC-6/Netrin to promote motor neuron axon outgrowth in C. elegans.
Dev Biol 2017 430(1) 249-261 
[ PubMed ID = 28694018 ] [ RRC reference ]