Mutants (Isolated)

tm4515

Allele Nametm4515
Sequence NameK10G6.2
CGC Namedos-2
Worm BaseAllele Name tm4515
CGC Name dos-2
Sequence K10G6.2
Phenotypehomozygous viable.
Mutation site22045/22046-22422/22423 (377 bp deletion)
ChromosomeII
Putative gene structurejoin(21605..21668, 21911..22043, 22089..22197, 22262..22362, 22605..22819, 22914..23119)
Map position-5.9
Balancer
Map position of balancer
Sequence of primersExtFwd:CTAGATGTAGAGCAAGCGCT,IntRev:CTCACCCAGACCATCATATC,IntFwd:TATTCGCCGGCGTCATTGAA,ExtRev:CAAAGGTCCGATGTGTTGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
SorkaƧ A, DiIorio MA, O'Hern PJ, Baskoylu SN, Graham HK, Hart AC.
LIN-12/Notch Regulates GABA Signaling at the Caenorhabditis elegans Neuromuscular Junction.
G3 (Bethesda) 2018 8(8) 2825-2832 
[ PubMed ID = 29950427 ] [ RRC reference ]

Singh K, Chao MY, Somers GA, Komatsu H, Corkins ME, Larkins-Ford J, Tucey T, Dionne HM, Walsh MB, Beaumont EK, Hart DP, Lockery SR, Hart AC.
C. elegans Notch signaling regulates adult chemosensory response and larval molting quiescence.
Curr. Biol. 2011 21(10) 825-34 
[ PubMed ID = 21549604 ] [ RRC reference ]