Mutants (Isolated)

tm4481

Allele Nametm4481
Sequence NameK07E3.7
CGC Namecatp-5
Worm BaseAllele Name tm4481
CGC Name catp-5
Sequence K07E3.7
Phenotypehomozygous viable.
Mutation site12860/12861-13565/13566 (705 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(10549..10731, 10778..10990, 11040..11201, 11244..11525, 11573..12052, 12105..12209, 12257..12395, 12789..13186, 13237..13587, 13968..14222, 14264..14453, 14502..14794, 14846..15049, 15498..15649, 15881..15926, 16402..16404))
Map position-0.56
Balancer
Map position of balancer
Sequence of primersIntFwd:CAGGATGATAGGTTGCTTGT,ExtRev:CGGAGTGTCTTCCAAGTAAT,ExtFwd:TGCAGCCACGGCACTGTCAA,IntRev:CAGCTTCTGGCTTACTGGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zielich J, Tzima E, Schröder EA, Jemel F, Conradt B, Lambie EJ.
Overlapping expression patterns and functions of three paralogous P5B ATPases in Caenorhabditis elegans.
PLoS ONE 2018 13(3) e0194451 
[ PubMed ID = 29547664 ] [ RRC reference ]