Home > Mutants (Isolated) > tm4481

Mutants (Isolated)

Allele Name		tm4481
Allele Type		Normal
Sequence Name		K07E3.7
Gene Name		catp-5
Worm Base	Allele Name	tm4481
	Gene Name	catp-5
	Sequence	K07E3.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		12860/12861-13565/13566 (705 bp deletion)
Chromosome		X
Putative gene structure		complement(join(10549..10731, 10778..10990, 11040..11201, 11244..11525, 11573..12052, 12105..12209, 12257..12395, 12789..13186, 13237..13587, 13968..14222, 14264..14453, 14502..14794, 14846..15049, 15498..15649, 15881..15926, 16402..16404))
Map position		-0.56
Balancer
Map position of balancer
Sequence of primers		IntFwd:CAGGATGATAGGTTGCTTGT,ExtRev:CGGAGTGTCTTCCAAGTAAT,ExtFwd:TGCAGCCACGGCACTGTCAA,IntRev:CAGCTTCTGGCTTACTGGGT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Vrijsen S, Besora-Casals L, van Veen S, Zielich J, Van den Haute C, Hamouda NN, Fischer C, Ghesquière B, Tournev I, Agostinis P, Baekelandt V, Eggermont J, Lambie E, Martin S, Vangheluwe P. ATP13A2-mediated endo-lysosomal polyamine export counters mitochondrial oxidative stress. Proc Natl Acad Sci U S A 2020 117(49) 31198-31207  [ PubMed ID = 33229544 ] [ RRC reference ] Zielich J, Tzima E, Schröder EA, Jemel F, Conradt B, Lambie EJ. Overlapping expression patterns and functions of three paralogous P5B ATPases in Caenorhabditis elegans. PLoS One 2018 13(3) e0194451  [ PubMed ID = 29547664 ] [ RRC reference ]