Allele Name | tm4481 |
Allele Type | Normal |
Sequence Name | K07E3.7 |
Gene Name | catp-5 |
Worm Base | Allele Name |
tm4481
|
Gene Name |
catp-5
|
Sequence |
K07E3.7
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 12860/12861-13565/13566 (705 bp deletion) |
Chromosome | X |
Putative gene structure | complement(join(10549..10731, 10778..10990, 11040..11201, 11244..11525, 11573..12052, 12105..12209, 12257..12395, 12789..13186, 13237..13587, 13968..14222, 14264..14453, 14502..14794, 14846..15049, 15498..15649, 15881..15926, 16402..16404)) |
Map position | -0.56 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:CAGGATGATAGGTTGCTTGT,ExtRev:CGGAGTGTCTTCCAAGTAAT,ExtFwd:TGCAGCCACGGCACTGTCAA,IntRev:CAGCTTCTGGCTTACTGGGT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Vrijsen S, Besora-Casals L, van Veen S, Zielich J, Van den Haute C, Hamouda NN, Fischer C, Ghesquière B, Tournev I, Agostinis P, Baekelandt V, Eggermont J, Lambie E, Martin S, Vangheluwe P. ATP13A2-mediated endo-lysosomal polyamine export counters mitochondrial oxidative stress. Proc Natl Acad Sci U S A 2020 117(49) 31198-31207
[ PubMed ID = 33229544 ]
[ RRC reference ]
|
Zielich J, Tzima E, Schröder EA, Jemel F, Conradt B, Lambie EJ. Overlapping expression patterns and functions of three paralogous P5B ATPases in Caenorhabditis elegans. PLoS One 2018 13(3) e0194451
[ PubMed ID = 29547664 ]
[ RRC reference ]
|
|