Mutants (Isolated)

tm4477

Allele Nametm4477
Sequence NameC02F5.6
CGC Namehenn-1
Worm BaseAllele Name tm4477
CGC Name henn-1
Sequence C02F5.6
Phenotypehomozygous viable.
Mutation site7132/7133-7505/7506 (373 bp deletion)
ChromosomeIII
Putative gene structurejoin(6193..6234, 6422..6873, 6928..7086, 7137..7491, 7539..7652, 7726..7863)
Map position-0.36
Balancer
Map position of balancer
Sequence of primersIntRev:AATCAATCGGGATCCCAATC,IntFwd:CCTACGTCGAAGCTTACGAA,ExtRev:TTACCTACCGTTCTCGGTTC,ExtFwd:GGGAGCTCCATATGATAATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Billi AC, Freeberg MA, Day AM, Chun SY, Khivansara V, Kim JK.
A conserved upstream motif orchestrates autonomous, germline-enriched expression of Caenorhabditis elegans piRNAs.
PLoS Genet. 2013 9(3) e1003392 
[ PubMed ID = 23516384 ] [ RRC reference ]

Billi AC, Alessi AF, Khivansara V, Han T, Freeberg M, Mitani S, Kim JK.
The Caenorhabditis elegans HEN1 ortholog, HENN-1, methylates and stabilizes select subclasses of germline small RNAs.
PLoS Genet. 2012 8(4) e1002617 
[ PubMed ID = 22548001 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]