Mutants (Isolated)

tm4450

Allele Nametm4450
Sequence NameH22K11.1
CGC Nameasp-3
Worm BaseAllele Name tm4450
CGC Name asp-3
Sequence H22K11.1
Phenotypehomozygous viable.
Mutation site19552/19553-GGGGT-19720/19721 (168 bp deletion + 5 bp insertion)
ChromosomeX
Putative gene structurejoin(19463..19521, 19602..19878, 19930..20034, 20088..20843)
Map position-2.43
Balancer
Map position of balancer
Sequence of primersExtRev:CCCATGAATCCAGAGAGGCA,IntRev:GGTGGATCCTCCGTTTCCGT,ExtFwd:GTCGCCTTGGCTTCTGCCAT,IntFwd:TTGGCTTCTGCCATCCAGAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Butler VJ, Gao F, Corrales CI, Cortopassi WA, Caballero B, Vohra M, Ashrafi K, Cuervo AM, Jacobson MP, Coppola G, Kao AW.
Age- and stress-associated C. elegans granulins impair lysosomal function and induce a compensatory HLH-30/TFEB transcriptional response.
PLoS Genet 2019 15(8) e1008295 
[ PubMed ID = 31398187 ] [ RRC reference ]