Mutants (Isolated)

tm445

Allele Nametm445
Sequence NameC50C10.7
CGC Namestr-2
Worm BaseAllele Name tm445
CGC Name str-2
Sequence C50C10.7
Phenotypehomozygous viable. Dr. G. Jansen: WT aging, WT chemotaxis to odorants. Dr. I. Katsura: J. Neurosci. 27, 741 (2007).
Mutation site16797/16798-18317/18318 (1520 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(17182..17616, 17946..18087, 18136..18270, 18304..18391, 18435..18522, 18570..18767))
Map position2.2
Balancer
Map position of balancer
Sequence of primersExtRev:AGCGAATCCCGTAGGAAAAA,ExtFwd:CCGAATTTCTCGTTAGCCGA,IntRev:GGAGTCAGTTAAGTGAAGCA,IntFwd:CTCATCGCTTGTTTGACAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Torayama I, Ishihara T, Katsura I.
Caenorhabditis elegans integrates the signals of butanone and food to enhance chemotaxis to butanone.
J. Neurosci. 2007 27(4) 741-50 
[ PubMed ID = 17251413 ] [ RRC reference ]