Mutants (Isolated)

tm4438

Allele Nametm4438
Sequence NameY59H11AR.2
CGC Namecatp-7
Worm BaseAllele Name tm4438
CGC Name catp-7
Sequence Y59H11AR.2
Phenotypehomozygous viable.
Mutation site9961/9962-TTTTTT-11183/11184 (1222 bp deletion + 6 bp insertion)
ChromosomeIV
Putative gene structurejoin(4085..4117, 8006..8164, 8372..9187, 9231..9455, 9510..9651, 9737..9840, 9913..10076, 10123..10234, 10282..10476, 10546..10736, 10820..10982, 11033..11365, 11438..11851, 11897..12028, 12093..12265, 12320..12347)
Map position3.91
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCCTTCGTCAGAAGAGCAT,IntFwd:ACATGCGGAGCTATTGACGT,ExtRev:CTGTCCGAACAATGATACCA,IntRev:ATACCATTGATGCCGTTGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zielich J, Tzima E, Schröder EA, Jemel F, Conradt B, Lambie EJ.
Overlapping expression patterns and functions of three paralogous P5B ATPases in Caenorhabditis elegans.
PLoS ONE 2018 13(3) e0194451 
[ PubMed ID = 29547664 ] [ RRC reference ]