Mutants (Isolated)

tm4393

Allele Nametm4393
Sequence NameF48B9.4
CGC Namenlp-37
Worm BaseAllele Name tm4393
CGC Name nlp-37
Sequence F48B9.4
Phenotypehomozygous viable.
Mutation site16637/16638-17038/17039 (401 bp deletion)
ChromosomeX
Putative gene structurejoin(16616..16720, 16785..16853, 16904..16999)
Map position-16.94
Balancer
Map position of balancer
Sequence of primersExtFwd:CCGCAGTAGCACATCTCTCA,IntFwd:CCGTAAACCATCAACTCTAG,ExtRev:GTTTCGGTGTCACAGGTGAC,IntRev:CGGTTTTGTGGTAGCCTCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Huang H, Hayden DJ, Zhu CT, Bennett HL, Venkatachalam V, Skuja LL, Hart AC.
Gap Junctions and NCA Cation Channels Are Critical for Developmentally Timed Sleep and Arousal in Caenorhabditis elegans.
Genetics 2018 210(4) 1369-1381 
[ PubMed ID = 30323068 ] [ RRC reference ]

Hilbert ZA, Kim DH.
PDF-1 neuropeptide signaling regulates sexually dimorphic gene expression in shared sensory neurons of C. elegans.
Elife 2018 7  
[ PubMed ID = 30024377 ] [ RRC reference ]

Choi S, Chatzigeorgiou M, Taylor KP, Schafer WR, Kaplan JM.
Analysis of NPR-1 reveals a circuit mechanism for behavioral quiescence in C. elegans.
Neuron 2013 78(5) 869-80 
[ PubMed ID = 23764289 ] [ RRC reference ]

Herrero A, Romanowski A, Meelkop E, Caldart CS, Schoofs L, Golombek DA.
Pigment-dispersing factor signaling in the circadian system of Caenorhabditis elegans.
Genes Brain Behav 2015 14(6) 493-501 
[ PubMed ID = 26113231 ] [ RRC reference ]

Barrios A, Ghosh R, Fang C, Emmons SW, Barr MM.
PDF-1 neuropeptide signaling modulates a neural circuit for mate-searching behavior in C. elegans.
Nat Neurosci 2012 15(12) 1675-82 
[ PubMed ID = 23143519 ] [ RRC reference ]

Flavell SW, Pokala N, Macosko EZ, Albrecht DR, Larsch J, Bargmann CI.
Serotonin and the neuropeptide PDF initiate and extend opposing behavioral states in C. elegans.
Cell 2013 154(5) 1023-1035 
[ PubMed ID = 23972393 ] [ RRC reference ]

Meelkop E, Temmerman L, Janssen T, Suetens N, Beets I, Van Rompay L, Shanmugam N, Husson SJ, Schoofs L.
PDF receptor signaling in Caenorhabditis elegans modulates locomotion and egg-laying.
Mol Cell Endocrinol 2012 361(1-2) 232-40 
[ PubMed ID = 22579613 ] [ RRC reference ]

Frooninckx L, Van Rompay L, Temmerman L, Van Sinay E, Beets I, Janssen T, Husson SJ, Schoofs L.
Neuropeptide GPCRs in C. elegans.
Front Endocrinol (Lausanne) 2012 3 167 
[ PubMed ID = 23267347 ] [ RRC reference ]