Mutants (Isolated)

tm4391

Allele Nametm4391
Sequence NameC34G6.5
CGC NameC34G6.5
Worm BaseAllele Name tm4391
CGC Name C34G6.5
Sequence C34G6.5
PhenotypeGro.
Mutation site2726/2727-3044/3045 (318 bp deletion)
ChromosomeI
Putative gene structurejoin(2166..2274, 2462..2831, 2877..2937, 2996..3106, 3151..3345, 3636..3819, 3863..3957, 4003..4113)
Map position0.47
Balancer
Map position of balancer
Sequence of primersIntRev:GTCCTTCACTATGAGCCATC,ExtFwd:TATTATAGGCGAGGGTACGT,ExtRev:GTCACTCGTAGTCCTTCACT,IntFwd:AGGGTACGTTTCCAGCTGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liachko NF, McMillan PJ, Strovas TJ, Loomis E, Greenup L, Murrell JR, Ghetti B, Raskind MA, Montine TJ, Bird TD, Leverenz JB, Kraemer BC.
The tau tubulin kinases TTBK1/2 promote accumulation of pathological TDP-43.
PLoS Genet 2014 10(12) e1004803 
[ PubMed ID = 25473830 ] [ RRC reference ]

Liachko NF, McMillan PJ, Guthrie CR, Bird TD, Leverenz JB, Kraemer BC.
CDC7 inhibition blocks pathological TDP-43 phosphorylation and neurodegeneration.
Ann Neurol 2013 74(1) 39-52 
[ PubMed ID = 23424178 ] [ RRC reference ]