| Allele Name | tm4391 |
| Sequence Name | C34G6.5 |
| CGC Name | C34G6.5 |
| Worm Base | Allele Name |
tm4391
|
| CGC Name |
C34G6.5
|
| Sequence |
C34G6.5
|
| Phenotype | Gro. |
| Mutation site | 2726/2727-3044/3045 (318 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(2166..2274, 2462..2831, 2877..2937, 2996..3106, 3151..3345, 3636..3819, 3863..3957, 4003..4113) |
| Map position | 0.47 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GTCCTTCACTATGAGCCATC,ExtFwd:TATTATAGGCGAGGGTACGT,ExtRev:GTCACTCGTAGTCCTTCACT,IntFwd:AGGGTACGTTTCCAGCTGAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Liachko NF, McMillan PJ, Strovas TJ, Loomis E, Greenup L, Murrell JR, Ghetti B, Raskind MA, Montine TJ, Bird TD, Leverenz JB, Kraemer BC.
The tau tubulin kinases TTBK1/2 promote accumulation of pathological TDP-43.
PLoS Genet. 2014 10(12) e1004803
[ PubMed ID = 25473830 ]
[ RRC reference ]
|
Liachko NF, McMillan PJ, Guthrie CR, Bird TD, Leverenz JB, Kraemer BC.
CDC7 inhibition blocks pathological TDP-43 phosphorylation and neurodegeneration.
Ann. Neurol. 2013 74(1) 39-52
[ PubMed ID = 23424178 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.