Mutants (Isolated)

tm4376

Allele Nametm4376
Sequence NameC03C11.2
CGC Namefog-3
Worm BaseAllele Name tm4376
CGC Name fog-3
Sequence C03C11.2
Phenotypelethal or sterile
Mutation site17437/17438-AA-17801/17802 (364 bp deletion + 2 bp insertion)
ChromosomeI
Putative gene structurejoin(17461..17532, 17583..17664, 17723..17824, 17874..17976, 18029..18153, 18211..18299, 18349..18437, 18482..18611)
Map position4.5
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntFwd:TCGTCGTGGGTGGTCTCATA,ExtFwd:ACGTTCGCAATGCATAGATG,IntRev:CGGACGAGATCTGAATTCAT,ExtRev:CTGAGGTACTTGATGACATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Snow JJ, Lee MH, Verheyden J, Kroll-Conner PL, Kimble J.
C. elegans FOG-3/Tob can either promote or inhibit germline proliferation, depending on gene dosage and genetic context.
Oncogene 2013 32(21) 2614-21 
[ PubMed ID = 22797076 ] [ RRC reference ]

Zanetti S, Puoti A.
Sex determination in the Caenorhabditis elegans germline.
Adv Exp Med Biol 2013 757 41-69 
[ PubMed ID = 22872474 ] [ RRC reference ]