Mutants (Isolated)

tm4374

Allele Nametm4374
Sequence NameR09B3.1
CGC Nameexo-3
Worm BaseAllele Name tm4374
CGC Name exo-3
Sequence R09B3.1
Phenotypehomozygous viable.
Mutation site2059/2060-2519/2520 (460 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(1650..1724, 2032..2247, 2308..2634, 2964..3212))
Map position12.91
Balancer
Map position of balancer
Sequence of primersIntRev:TCATCCTTCCATCCGCCGAC,ExtFwd:TCCACCGGGATTTTACGGGA,IntFwd:GCTTCCAGACGAGACCTTAT,ExtRev:CGCGTCAACCTCGCCAACAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kato Y, Miyaji M, Zhang-Akiyama QM.
FUdR extends the lifespan of the short-lived AP endonuclease mutant in Caenorhabditis elegans in a fertility-dependent manner.
Genes Genet Syst 2017 91(4) 201-207 
[ PubMed ID = 27582048 ] [ RRC reference ]

Miyaji M, Hayashi Y, Funakoshi M, Tanaka A, Zhang-Akiyama QM.
AP endonuclease EXO-3 deficiency causes developmental delay and abnormal vulval organogenesis, Pvl, through DNA glycosylase-initiated checkpoint activation in Caenorhabditis elegans.
Sci Rep 2018 8(1) 16736 
[ PubMed ID = 30425296 ] [ RRC reference ]

Papaluca A, Wagner JR, Saragovi HU, Ramotar D.
UNG-1 and APN-1 are the major enzymes to efficiently repair 5-hydroxymethyluracil DNA lesions in C. elegans.
Sci Rep 2018 8(1) 6860 
[ PubMed ID = 29717169 ] [ RRC reference ]

SenGupta T, Torgersen ML, Kassahun H, Vellai T, Simonsen A, Nilsen H.
Base excision repair AP endonucleases and mismatch repair act together to induce checkpoint-mediated autophagy.
Nat Commun 2013 4 2674 
[ PubMed ID = 24154628 ] [ RRC reference ]

Kato Y, Moriwaki T, Funakoshi M, Zhang-Akiyama QM.
Caenorhabditis elegans EXO-3 contributes to longevity and reproduction: differential roles in somatic cells and germ cells.
Mutat Res 2015 772 46-54 
[ PubMed ID = 25772110 ] [ RRC reference ]