Mutants (Isolated)

tm4373

Allele Nametm4373
Sequence NameD2045.1
CGC Nameatx-2
Worm BaseAllele Name tm4373
CGC Name atx-2
Sequence D2045.1
PhenotypeLet or Ste
Mutation site14234/14235-14679/14680 (445 bp deletion)
ChromosomeIII
Putative gene structurejoin(13448..13799, 13853..14074, 14310..14719, 14857..15171, 15279..15566, 16022..16238, 16296..16396)
Map position2.51
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:CTCCAGAGTTCAAGCCACGT,IntRev:GGCCTTGGTACTGTGAATGA,IntFwd:GACTCCAACAGCGACGACTC,ExtRev:TTGGTATGGAGCAGCTTGCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Lowry J, Yochem J, Chuang CH, Sugioka K, Connolly AA, Bowerman B.
High-Throughput Cloning of Temperature-Sensitive Caenorhabditis elegans Mutants with Adult Syncytial Germline Membrane Architecture Defects.
G3 (Bethesda) 2015 5(11) 2241-55 
[ PubMed ID = 26311651 ] [ RRC reference ]