Mutants (Isolated)

tm4344

Allele Nametm4344
Sequence NameK10D2.2
CGC Namepup-2
Worm BaseAllele Name tm4344
CGC Name pup-2
Sequence K10D2.2
Phenotypehomozygous viable.
Mutation site19350/19351-TT-19931/19932 (581 bp deletion + 2 bp insertion)
ChromosomeIII
Putative gene structurejoin(18888..18902, 18950..19187, 19263..19329, 19380..19793, 19855..20369, 20418..20575, 20638..20757)
Map position-2.03
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGACCACAAGATCCCTCAC,ExtRev:GAAAGAAACTCCGAGCGCAT,ExtFwd:TCACTGGACACCACTGACCA,IntRev:CTTGGCATATCAACACCTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Van Wynsberghe PM, Kai ZS, Massirer KB, Burton VH, Yeo GW, Pasquinelli AE.
LIN-28 co-transcriptionally binds primary let-7 to regulate miRNA maturation in Caenorhabditis elegans.
Nat Struct Mol Biol 2011 18(3) 302-8 
[ PubMed ID = 21297634 ] [ RRC reference ]

Li Y, Maine EM.
The balance of poly(U) polymerase activity ensures germline identity, survival and development in Caenorhabditis elegans.
Development 2018 145(19)  
[ PubMed ID = 30305273 ] [ RRC reference ]

Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]