Mutants (Isolated)

tm4343

Allele Nametm4343
Sequence NameC36C9.1
CGC NameC36C9.1
Worm BaseAllele Name tm4343
CGC Name C36C9.1
Sequence C36C9.1
Phenotypehomozygous viable.
Mutation site17026/17027-G-17622/17623 (596 bp deletion + 1 bp insertion)
ChromosomeX
Putative gene structurejoin(15882..15939, 15986..17456, 17505..17588, 17637..17783, 17832..17966, 18482..18759, 18809..19134)
Map position-17.78
Balancer
Map position of balancer
Sequence of primersExtFwd:GTAATTTCAGGTCACCGCTC,ExtRev:CTTCCTTCCCAGAAACCGTG,IntFwd:CCGCTCTCATAGTCGAAGCA,IntRev:GCGGAGTACATTGGTGACTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen JX, Cipriani PG, Mecenas D, Polanowska J, Piano F, Gunsalus KC, Selbach M.
In Vivo Interaction Proteomics in Caenorhabditis elegans Embryos Provides New Insights into P Granule Dynamics.
Mol Cell Proteomics 2016 15(5) 1642-57 
[ PubMed ID = 26912668 ] [ RRC reference ]