Mutants (Isolated)

tm4324

Allele Nametm4324
Sequence NameF46B6.8
CGC Namelipl-2
Worm BaseAllele Name tm4324
CGC Name lipl-2
Sequence F46B6.8
Phenotypehomozygous viable.
Mutation site22802/22803-23312/23313 (510 bp deletion)
ChromosomeV
Putative gene structurejoin(22617..22721, 22764..22863, 22922..23026, 23073..23440, 23693..24250)
Map position2.2
Balancer
Map position of balancer
Sequence of primersIntRev:GTGTGTTCACGTGGAAGCCT,ExtRev:CAGGGATCTGGATCATGTAA,IntFwd:GCTCATCTGATCTCCGGACT,ExtFwd:TCACCGTTGAGATTTGTGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, Boyko A, Mazer T, Ang S, Khopkar R, Javaheri A, Kumar S, Jiang X, Ory D, Mani K, Matkovich SJ, Kornfeld K, Diwan A.
Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival.
PLoS Biol 2019 17(5) e3000245 
[ PubMed ID = 31086360 ] [ RRC reference ]