Mutants (Isolated)

tm4300

Allele Nametm4300
Sequence NameY105C5B.2
CGC Namegcy-25
Worm BaseAllele Name tm4300
CGC Name gcy-25
Sequence Y105C5B.2
Phenotypehomozygous viable.
Mutation site11322/11323-TTTAGCAAAAA-11702/11703 (380 bp deletion + 11 bp insertion)
ChromosomeIV
Putative gene structurejoin(9237..9376, 9773..9958, 10602..10692, 11203..11350, 11400..11508, 11878..12050, 12102..12490, 13159..13500, 13791..13862, 13916..14095, 14527..14713, 15519..15677, 15866..16076, 16608..16751, 16997..17120, 17518..17691, 17822..17931, 18108..18261, 18511..18648, 19728..19772)
Map position14.45
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCTTGCGAAATGTTAGTGT,IntFwd:CAGTACGTACTAAGTGGATC,ExtRev:TTGAGGGAGGGAATTCCTGA,IntRev:GCGAACTCCAAATGCTAATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M.
Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans.
PLoS Genet. 2011 7(10) e1002335 
[ PubMed ID = 22022287 ] [ RRC reference ]

Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N.
Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(1) 254-9 
[ PubMed ID = 21173231 ] [ RRC reference ]