| Allele Name | tm4275 |
| Sequence Name | B0414.8 |
| CGC Name | B0414.8 |
| Worm Base | Allele Name |
tm4275
|
| CGC Name |
B0414.8
|
| Sequence |
B0414.8
|
| Phenotype | homozygous viable. |
| Mutation site | 34926/34927-35193/35194 (267 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(32498..32650, 33051..33209, 33256..33337, 33554..33652, 33706..34003, 34070..34223, 34294..34623, 34672..35103, 35163..35324, 35376..35550, 35594..35652)) |
| Map position | 0.46 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GTCCTGGAGACACCATCGAT,IntFwd:CAGATTTGCAAGAGCGGTCT,ExtRev:CGCGCAATGATGTTCCACAA,ExtFwd:TCGCTAGCTGTGAACAAGAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Luo L, Hannemann M, Koenig S, Hegermann J, Ailion M, Cho MK, Sasidharan N, Zweckstetter M, Rensing SA, Eimer S.
The Caenorhabditis elegans GARP complex contains the conserved Vps51 subunit and is required to maintain lysosomal morphology.
Mol Biol Cell 2011 22(14) 2564-78
[ PubMed ID = 21613545 ]
[ RRC reference ]
|
Topalidou I, Cattin-Ortolá J, Pappas AL, Cooper K, Merrihew GE, MacCoss MJ, Ailion M.
The EARP Complex and Its Interactor EIPR-1 Are Required for Cargo Sorting to Dense-Core Vesicles.
PLoS Genet 2016 12(5) e1006074
[ PubMed ID = 27191843 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.