Mutants (Isolated)

tm4275

Allele Nametm4275
Sequence NameB0414.8
CGC NameB0414.8
Worm BaseAllele Name tm4275
CGC Name B0414.8
Sequence B0414.8
Phenotypehomozygous viable.
Mutation site34926/34927-35193/35194 (267 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(32498..32650, 33051..33209, 33256..33337, 33554..33652, 33706..34003, 34070..34223, 34294..34623, 34672..35103, 35163..35324, 35376..35550, 35594..35652))
Map position0.46
Balancer
Map position of balancer
Sequence of primersIntRev:GTCCTGGAGACACCATCGAT,IntFwd:CAGATTTGCAAGAGCGGTCT,ExtRev:CGCGCAATGATGTTCCACAA,ExtFwd:TCGCTAGCTGTGAACAAGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Luo L, Hannemann M, Koenig S, Hegermann J, Ailion M, Cho MK, Sasidharan N, Zweckstetter M, Rensing SA, Eimer S.
The Caenorhabditis elegans GARP complex contains the conserved Vps51 subunit and is required to maintain lysosomal morphology.
Mol Biol Cell 2011 22(14) 2564-78 
[ PubMed ID = 21613545 ] [ RRC reference ]

Topalidou I, Cattin-Ortolá J, Pappas AL, Cooper K, Merrihew GE, MacCoss MJ, Ailion M.
The EARP Complex and Its Interactor EIPR-1 Are Required for Cargo Sorting to Dense-Core Vesicles.
PLoS Genet 2016 12(5) e1006074 
[ PubMed ID = 27191843 ] [ RRC reference ]